Preparation of Pec-Zein and Pec-Zein-IPA NPs
Zein (240 mg) (aladdin, Z304904) was dissolved in 6 mL of 80% ethanol. The mixture was added to 20 mL of ultra-pure water containing 1.25% sodium deoxycholate (SD) (aladdin, S104198) and stirred at 1000 g for 10 min. The amount of IPA (MCE, HY-W015229) added to Zein NPs was 0.1-1.0 mg/mL. Zein-IPA NPs solution was stirred at 800 g for 10 h to evaporate ethanol. Zein-IPA NPs were then placed in a dialysis bag (12000–14000 Da, Solarbio), PBS was added to 37°C and stirred for 1 h to remove free IPA and Zein-IPA NPs were obtained after freeze-drying. Pec-Zein-IPA NPs were prepared for animal experiments by mixing 60 mg pectin (aladdin, P112756) with 200 mL ultrapure water and stirring it for 30 min at 1000 g.
Characteristics of Zein-IPA NPs and Pec-Zein-IPA NPs
The Zein-IPA NPs and Pec-Zein-IPA NPs were dissolved in PBS and the particle size and Zeta potential were determined using the Zetasizer Nano ZS90. FEI Tecnai G2 F30 and SU8020 instruments were used to examine the Zein-IPA NPs and Pec-Zein-IPA NPs surface morphology.
The encapsulation efficiency and release of IPA in vitro and in vivo
Using FITC-labeled BSA (Solarbio, SF063) instead of IPA to observe drug release in vivo. Prepare Pec-Zein NPs loaded with FITC-labeled BSA using the above method. After freeze-drying the nanoparticles, reconstitute NPs for oral gavage administration to SCI mice. At corresponding time points, the mice were anesthetized with isoflurane, and images were captured using a small animal in vivo imaging system (IVIS Spectrum). Pepsin (Aladdin, P755347) and trypsin (Aladdin, E757753) were purchased from Aladdin to simulate the stomach and small intestine environment. As previously described [18], Zein-IPA NPs and Pec-Zein-IPA NPs were placed in a dialysis bag suspended in (100 mL PBS with 1% Tween80 and pepsin, pH 1.2) simulated gastric fluid (sgf) and stirred at 100 g to induce the gastric transport state at 37℃. To simulate the intestinal tract, the dialysis bags were suspended (100 mL PBS with 1% Tween 80 and trypsin, pH 6.8) and stirred at 100 g at 37°C. The dialysis bag was then placed in 100 mL PBS containing 1% Tween80, pH 7.4, harvested from a 20% microbiota filter and stirred at 37°C at 100 g. Next, the 2 mL PBS was collected after 0.5, 1, 2, 4, 8 and 24 h, respectively, and the new medium was added to PBS. NPs prepared with Zein-IPA were centrifuged at 4°C for 1 h using the BeckmanOtima100 instrument. Afterward, supernatant was collected and the absorbance of IPA was detected at 283 nm. The encapsulation of Zein-IPA NPs was finally calculated using the following formula:
$$\begin{aligned}&\text{Encapsulation}\,\text{efficiency}\cr&\quad=\left(1- \frac{\begin{aligned}&\text{the}\:\text{amount}\text{of}\,\text{free}\,\text{IPA}\cr&\quad\text{in}\,\text{the}\,\text{supernatant}\end{aligned}}{\text{the}\,\text{amount}\,\text{of}\,\text{total}\,\text{IPA}}\right)\end{aligned}$$
Animals
Healthy two hundred female C57BL6/J mice were purchased from Gempharmatech Co.Ltd. and kept in standard conditions. The experimental protocols and procedures were approved by the Experimental Animal Ethics Committee at Wenzhou Medical University, Zhejiang Province, (No. wydw2018-0043), and in accordance with the ARRIVE guidelines (Animals in Research: Reporting In Vivo Experiments) [19].
SCI mice and drug intervention
Female mice were fully anesthetized with isoflurane. Then, skin and muscles and the dorsal cord were exposed using an anesthesia machine. SCI model was established by using a vascular clamp for 1 min (30 g force, Oscar) after a T9-T10 segmental laminectomy [20]. The skin and muscles from back in the sham group were isolated without being injured. The mice were randomly allocated into groups of SCI, IPA, Pec-Zein NPs and Pec-Zein-IPA NPs. The mice in the IPA group received 40 mg/kg/day of IPA, while the mice in Pec-Zein-IPA group received nanoparticles (containing same amount of IPA compared to the IPA treatment group) daily. The mice of Pec-Zein group received the same nanoparticles without IPA and those in the SCI group received normal saline solution. The body function of all mice was restored by artificial bladder emptying twice daily following injury.
Motor function recovery
BMS scores were calculated according to the previously described method for 1, 3, 7, 14 dpi in mice following SCI [21]. The BMS score ranged from 0 (paralyzed) to 9 (normal) based on coordination, retro ankle range of motion, tail pose, trunk stability and sole pose. Neuroexam M-800 (medcomtech) was used to evaluate nerve function at the injured site 14 days after injury. Electrodes were placed on the gastrocnemius muscle of the hind limb to record the amplitude of the action potential.
HE and nissl staining
HE and Nissl staining kits (Solarbio) were used to stain the spinal cords of mice after the tissue was fixed and the 5 cm tissue sections were dewaxed and hydrated. The spinal cords were then stained as described in the kit instructions. The images were finally captured using a Nikon microscope.
Immunofluorescence staining
Spinal cord tissue sections were sufficiently dehydrated and blocked for endogenous catalase, repaired with sodium citrate under high pressure and incubated with primary antibody for Arg-1 (Proteintech, 66129-1-lg), GFAP (Santa Cruz Biotechnology, sc-33673), Neun (Abcam, ab104224), C-caspase 3 (Affinity, AF7022), iNOS (Abcam, ab178945), NF200 (Abcam, ab207176), TOM20 (Proteintech, 11802-1-AP), ZO-1 (Proteintech, 66452-1-lg) and Occludin (Proteintech, 27260-1-AP) at 4°C overnight. Next, tissue slide was adequately incubated with secondary antibody at room temperature for 1.5 h. DAPI-labeled nucleus and spinal cord images were obtained and analyzed by Nikon C2si and OLYMPUS VS200.
Western blot assay
The spinal cord protein was extracted using a protein extraction kit, isolated using Epizyme Biotech’s 7.5-12.5% PAGE Gel Fast Preparation Kit (Epizyme Biotech) and transferred to PVDF membranes. Afterward, the samples were adequately blocked with QuickBlockTM Western (Beyotime) for 15 min and then incubated with primary antibodies such as Bcl-2 (Proteintech, 26593-1-AP), SOD2 (Proteintech, 24127-1-AP), NQO1 (Proteintech, 11451-1-AP), HO-1 (Proteintech, 10701-1-AP), Bax (Proteintech, 50599-2-lg), Nrf-2 (ZENBIOSCIENCE, 380773), p-AKT(ZENBIOSCIENCE, 381555), AKT (ZENBIOSCIENCE, R23412), p-p65 (ZENBIOSCIENCE, 310013), p65 (ZENBIOSCIENCE, 250060), p-mTOR (ZENBIOSCIENCE, 381557), mTOR (ZENBIOSCIENCE, 660108), NLRP3 (Abcam, 263899), Caspase1 (Affninty, AF4005), GSDMD (Affninty, AF4012), LC3 (HUABIO, ET1701-65), p62 (ZENBIOSCIENCE, 380612), SAMTOR (Proteintech, 21744-1-AP) and GAPDH (ZENBIOSCIENCE, 380626) overnight at 4°C. The secondary antibodies were then incubated for 2.5 h. The images of PVDF membranes were finally obtained using the chemiDoc XRS + software and quantified using Image Lab 5.2.
Quantitative RT-PCR (qRT-PCR)
Trizol (takera) reagent was used to extract total RNA from spinal cord tissue according to the supplier’s instructions. cDNA was synthesized by PrimeScriptTM RT Master Mix (Takara) and qRT-PCR was performed using the TB green method. Finally, the mRNA expression was calculated and analyzed by 2 − ΔΔCt. Forward primer (5’-3’): IL-1β (TTTGAAGTTGACGGACCCCAA), CD86 (ACAGAGAGACTATCAACCTG), TNF-α (ACGGCATGGATCTCAAAGAC), GAPDH (GGCAAATTCAACGGCACAGTCAAG), IL-6 (CTCCCAACAGACCTGTCTATAC); Reverse primer (5’-3’): IL-1β (CACAGCTTCTCCACAGCCACA), CD86 (GAATTCCAATCAGCTGAGAAC), TNF-α (AGATAGCAAATCGGCTGACG), GAPDH (TCGCTCCTGGAAGATGGTGATGG), IL-6 (CCATTGCACAACTCTTTTCTC).
Amplification, sequencing and analysis of 16S rRNA gene
Fecal (30 mg) were sequenced for 16S RNA analysis. The quality of DNA extraction was determined by 1.2% agarose gel electrophoresis after DNA extraction using Nanodrop. The Quant-iTPicoGreen dsDNA Assay Kit and Microplate Reader (BioTek, FLx800) were used to amplify the recovered products using a Fluorescence Assay Kit and PCR amplification. The samples were mixed according to their sequencing quantities based on the fluorescence quantitative results. The sequencing libraries were prepared utilizing Illumina’s TruSeq Nano DNA LT Library Prep Kit. Magnetic bead screening was used to remove joint self-contiguous segments and purification of the library system was performed after the addition of the joint. BECKMAN AMPure XP Beads were used to obtain the library enrichment products after amplifying the DNA fragments involved in splices by PCR. The library was finalized using 2% agarose gel electrophoresis to select and purify the fragments. The samples were sorted and categorized according to index and barcode information from the original sequence of quality preliminary screening. QIIME2 dada2 or Vsearch software analysis flows were followed for sequence denoising or OTU clustering. The sparse curve was evaluated using ASV/OUT distributions in different samples. ASV/OTU level distance matrix calculations, β and α diversity measurement were conducted using unsupervised sorting, clustering and statistical analyzing methods.
Extraction and analysis of fecal metabolites
A total of 25 female mice were were used for fecal metabolome analysis. The sample (50 mg) was placed in an EP tube with 2 medium steel balls. Then, 200 µL of pre-cooled 80% methanol aqueous solution was mixed and homogenized in a tissue breaker. Next, 800 µL was added, ultrasounded in an ice bath for 20 min and frozen at -20℃ for 1 h. The supernatant was obtained by centrifuging 16,000 g at 4°C for 20 min, then drying in high-speed vacuum enrichment centrifuges. Mass spectrometry analysis was performed with 100 mL of methanol-aqueous solution (1:1, v/v) redissolved and centrifuged for 15 min and the supernatant was collected for analysis. The sample volume was 4 µL, the column temperature was 40°C and the flow rate was 0.3 mL/min. For chromatographic gradient elution, the chromatographic mobile phase A is 0.1% formic acid solution and the mobile phase B is acetonitrile. In 2–6 min, B changes linearly from 0 to 48%. 6–10 min, B changed linearly from 48 to 100%; 10–12 min, B maintained at 100%; At 12–12.1 min, B changed linearly from 100 to 0% and at 12.1–15 min, B remained at 0%. The positive (+) and negative (-) modes of each sample were detected utilizing electrospray ionization (ESI). The samples were then separated by UPLC, analyzed by mass spectrometry using QE Plus mass spectrometer (Thermo Scientific) and ionized using an HESI source. Peak alignment, retention time correction and peak area extraction for raw data were performed using MSDIAL software. The total peak area of the positive and negative data for positive and negative ions was normalized, the peaks of the positive and negative ions were integrated and patterns were recognized using Python. The data were preprocessed by Unit variance scaling (UV) before being analyzed.
Fecal supernatant transplantation
For fecal transplantation, the feces of mice with SCI were collected and 50 mg feces were diluted with 1 mL sterile saline. The mixed sample was centrifuged at 100 g, 4℃, for 5 min, and the supernatant was filtered through 70 μm filter. SCI mice were given 100 µL fecal supernatant daily.
BV2 cells culture and drug treatment
The BV2 cells were purchased from Shanghai Zhongqiaoxinzhou Biotech (ZQ0397). BV2 cells were cultured in MEM medium with 10% fetal bovine serum, 1% penicillin-streptomycin solution and 5% CO2 at 37°C. BV2 cells were treated with SAM or Met for 2 h after being divided into LPS + ATP, LPS + ATP + Met and LPS + ATP + SAM groups.
Intestinal permeability analysis
Briefly, the mice were fasted for 4 h at 14 dpi, and intragastric administration with 12 mg/20 g FITC-dextran (Sigma, FD4), then blood centrifugation was taken to obtain the supernatant after 4 h. The absorbance of the supernatant was analyzed at Em = 520 nm and Ex = 481 nm using a microplate reader.
Molecular docking
To evaluate the binding energy and interaction patterns of candidate SAM with SAMTOR, we employed AutodockVina 1.2.2, a computerized protein-ligand docking software. We from PubChem compound database (https://pubchem.ncbi.nlm.nih.gov/), SAM, Met and SAMTOR were downloaded from PDB (http://www.rcsb.org/). We first prepared the protein and ligand files, converted all the protein and molecular files to PDBQT format, removed all the water molecules, and added polar hydrogen atoms. The grid frame is centered to cover each protein domain and accommodate free molecular motion. Molecular docking studies by Autodock Vina 1.2.2 (http://autodock.scripps.edu/) is used to model visualization.
Statistical analysis
The analysis and modeling of multivariate data were performed using R (version 4.0.3) and R packages. The data were mean-centered using Pareto scaling. The models were developed using principal component analysis (PCA), orthogonal partial least-square discriminant analysis (PLS-DA), and partial least-square discriminant analysis (OPLS-DA). Permutation tests were performed to evaluate all models for overfitting. The OPLS-DA method was used to identify discriminating metabolites based on the variable importance of projection (VIP). The discriminating metabolites were obtained using a statistically significant threshold of VIP values obtained from the OPLS-DA model and two-tailed Student’s t test on the normalized raw data at univariate analysis level. Experimental data were analyzed using GraphPad Prism 8.0.2 software and were presented as mean ± SEM. ANOVA and Tukey’s multiple comparison tests were used to compare two or more groups. VIP > 1, p < 0.05 was considered statistically significant.
